Review




Structured Review

Millipore corest protein
Corest Protein, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/corest protein/product/Millipore
Average 90 stars, based on 1 article reviews
corest protein - by Bioz Stars, 2026-04
90/100 stars

Images



Similar Products

90
Eurofins Genomics 50 primer for cloning corest (aa 86) protein into pleics12 vector: gtattttcagggcgccatgtg ggaggaaggcagc
50 Primer For Cloning Corest (Aa 86) Protein Into Pleics12 Vector: Gtattttcagggcgccatgtg Ggaggaaggcagc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/50 primer for cloning corest (aa 86) protein into pleics12 vector: gtattttcagggcgccatgtg ggaggaaggcagc/product/Eurofins Genomics
Average 90 stars, based on 1 article reviews
50 primer for cloning corest (aa 86) protein into pleics12 vector: gtattttcagggcgccatgtg ggaggaaggcagc - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins Genomics 30 primer for cloning corest protein (aa 485) into pleics12 vector: gacggagctcgaatttcagg aggcagatgcatatct
30 Primer For Cloning Corest Protein (Aa 485) Into Pleics12 Vector: Gacggagctcgaatttcagg Aggcagatgcatatct, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/30 primer for cloning corest protein (aa 485) into pleics12 vector: gacggagctcgaatttcagg aggcagatgcatatct/product/Eurofins Genomics
Average 90 stars, based on 1 article reviews
30 primer for cloning corest protein (aa 485) into pleics12 vector: gacggagctcgaatttcagg aggcagatgcatatct - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
BPS Bioscience corest protein
Corest Protein, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/corest protein/product/BPS Bioscience
Average 90 stars, based on 1 article reviews
corest protein - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
NeuroMab corest recombinant fusion protein to a region of human co-rest
Antibodies used in this study
Corest Recombinant Fusion Protein To A Region Of Human Co Rest, supplied by NeuroMab, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/corest recombinant fusion protein to a region of human co-rest/product/NeuroMab
Average 90 stars, based on 1 article reviews
corest recombinant fusion protein to a region of human co-rest - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Millipore corest protein
Antibodies used in this study
Corest Protein, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/corest protein/product/Millipore
Average 90 stars, based on 1 article reviews
corest protein - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Antibodies used in this study

Journal: The Journal of comparative neurology

Article Title: Dissecting LSD1-Dependent Neuronal Maturation in the Olfactory Epithelium

doi: 10.1002/cne.24259

Figure Lengend Snippet: Antibodies used in this study

Article Snippet: Information on the antibodies is derived from the manufacturers’ description, the literature, and our own data. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primary Antibody Immunogen Source, species, clonality, catalog#, RRID Dilution, staining protocol beta-actin Beta-actin N-terminal peptide ThermoFisher, mouse monoclonal, cat # MA5–15739 (clone BA3R), RRID: AB_10979409 1:1,000 for Western blot beta-gal Bacterial beta-galactosidase Abcam, chicken polyclonal, cat # ab9361, RRID: AB_307210 1:750 directly conjugated (5 min trypsin digest) CK14 Recombinant human KRT14 Proteintech, rabbit polyclonal, cat # 10143–1-AP, RRID: AB_2134831 1:1,000 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) CoREST Recombinant fusion protein to a region of human Co-REST NeuroMab, Mouse monoclonal, cat#75–039 (clone K72/8), RRID: AB_2301051 1:500 TSA (5 min 3% H 2 O 2 in methanol +10 min steam) GAP43 Synthetic peptide corresponding to residues on the C-terminus of human GAP43 Abcam, rabbit monoclonal, cat #ab75810, RRID: AB_1310252 1:1,000 TSA (5 min 3% H 2 O 2 in methanol) GFP Recombinant full length protein Abcam, chicken polyclonal, cat #ab13970, RRID: AB_300798 1:250 directly conjugated (tertiary for M72-GFP only) HDAC2 Synthetic peptide corresponding to amino acids 417–488 of human HDAC2 Abcam, mouse monoclonal, cat #ab12169, RRID: AB_2118547 1:100 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) LSD1 Synthetic peptide corresponding to Human KDM1/LSD1 aa 50–150 Abcam, rabbit monoclonal, cat #ab129195, RRID: AB_11145494 1:20,000 TSA (5 min 3% H 2 O 2 in methanol +10 min steam) OMP Synthetic peptide mapping within an internal region of human OMP Santa Cruz Biotechnology Inc, goat polyclonal, cat# sc-49070, RRID: AB_2158008 1:200 directly conjugated in steamed tissue, and 1:200 with TSA in non-steamed tissue MOR28 MOR28 extracellular epitope (amino acids 167–182) Gilad Barnea PhD Brown University, rabbit polyclonal, RRID: AB_2636804 1:5000 tertiary (5 min 3% H 2 0 2 in methanol +10 min steam) TdT Recombinant fusion protein to full length aa sequence from the mush-room polyp coral Discosoma Rockland Antibodies, rabbit polyclonal, cat #600–401-379, RRID: AB_2209751 1:200 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) Tuj1 Rat brain microtubules BioLegend, mouse monoclonal, cat # 801202 (clone TUJ1), RRID: AB_10063408 1:200 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) Open in a separate window Antibodies used in this study Anti-β-actin from ThermoFisher was used for a loading control in Western blots.

Techniques: Staining, Western Blot, Recombinant, Serial Time-encoded Amplified Microscopy, Sequencing